View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16444_high_10 (Length: 352)
Name: NF16444_high_10
Description: NF16444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16444_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 54376518 - 54376781
Alignment:
| Q |
18 |
aggcgatccggcggagagatactccggcggtggacatttatcgcaaatccacgagagtttatccgagaattgcgatggattttgtgcaatgaggtcgcat |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54376518 |
aggcgatccggcggaaagatactccggcggtggacatttatcgcaaatccacgagagtttatcggagaattgcgatggattttgtgcaatgaggtcgcat |
54376617 |
T |
|
| Q |
118 |
aattcgatcaacgcttccatcacgaattagggtgaaaattcaaacgaaaaatgagagaatgttgagatttcagaagagatcgtggcgttcgattctctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54376618 |
aattcgatcaacgcttccatcacgaattagggtgaaaattcaaacgaaaaatgagagaatgttgagatttcagaagagatcgtggcgttcgattctctct |
54376717 |
T |
|
| Q |
218 |
ctaaccacgtaccaacattgttactcttcttctcgtcgttgcagtttccatgccatggttaatg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54376718 |
ctaaccacgtaccaacattgttactcttcttctcgtcgttgcagtttccatgccatggttaatg |
54376781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University