View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16444_high_11 (Length: 351)
Name: NF16444_high_11
Description: NF16444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16444_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 47 - 341
Target Start/End: Complemental strand, 19175828 - 19175523
Alignment:
| Q |
47 |
cgtgtatggtgtcagtgcttcataaaatttggcaacaagtaaaagacaagaaca-----------atgtagcaacaaacctacctagcactgggaggtgt |
135 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175828 |
cgtgtctggtgtcagtacttcataaaatttggcaacaagtaaaagacaagaacatgataagaacaatgtagcaacaaacctacctagcactgggaggtgt |
19175729 |
T |
|
| Q |
136 |
agtggggacttgaggtacaagctcaagaggcaaacccaagaaaccattaaacctatcaaaggtgacatgtgcaagatggcgcacgttagtagggtgacca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19175728 |
agtggggacttgaggtacaagctcaagaggcaaacccaagaaaccattaaacctatcaaaggtgacatgtgcaagatggcgcacattagtagggtgacca |
19175629 |
T |
|
| Q |
236 |
atttccatggcagaagcatcactagcgcaagaaactagggatttcctgaaaagggtcacgagaatggccaaaaaggatatctcttgctctgttttttccc |
335 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||| ||| |
|
|
| T |
19175628 |
atttccatggcagaagcatcactggcgcaagaaactagggatttcctgaaaagggtcacaagaatggccaaaaaggataactcttgctctgtctttgccc |
19175529 |
T |
|
| Q |
336 |
tctctg |
341 |
Q |
| |
|
|||||| |
|
|
| T |
19175528 |
tctctg |
19175523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 225
Target Start/End: Complemental strand, 36405940 - 36405878
Alignment:
| Q |
163 |
aggcaaacccaagaaaccattaaacctatcaaaggtgacatgtgcaagatggcgcacgttagt |
225 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || || || || | ||||||||||||||| |
|
|
| T |
36405940 |
aggcaaacccaagaaaccattgaacctatcaaaagtaacgtgagcgacatggcgcacgttagt |
36405878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University