View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16444_low_19 (Length: 285)
Name: NF16444_low_19
Description: NF16444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16444_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 270
Target Start/End: Complemental strand, 26666273 - 26666014
Alignment:
| Q |
11 |
ttattctaattagagcaacataagtgaaataaaaaagtttaaattttcattgaagaaattagttgtcaaattaattccaaaaagtctctctcttgagagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26666273 |
ttattctaattagagcaacataagtgaaataaaaaagtttaaattttcattgaagaaattagttgtcaaattaattccaaaaagtctctctcttaagagg |
26666174 |
T |
 |
| Q |
111 |
ctcataatcttggaatacattggaagatgaggaagaagaagaaggaaagttaatatattgtggaagaactccatagcaattactattttcagatagtatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26666173 |
ctcataatcttggaatacattggaagatgaggaagaagaagaaggaaagttaatatattgtggaagaactccatagcaattactactttcagatagtatc |
26666074 |
T |
 |
| Q |
211 |
atcaatttgtcatcttgatcatcaacatgtgttggtaatgagttggtaaccgtagtagat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26666073 |
atcaatttgtcatcttgatcatcaacatgtgttggtaatgagttggtaaccgtagtagat |
26666014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University