View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16444_low_8 (Length: 466)
Name: NF16444_low_8
Description: NF16444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16444_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 110 - 459
Target Start/End: Original strand, 52221185 - 52221550
Alignment:
| Q |
110 |
tgactggtagtgtttattggtgtgttggtatgaatcccgacgagagggaatgaaccaatgaataagtgacacgttggattgggaaggtgggttctttaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52221185 |
tgactggtagtgtttattggtgtgttggtatgaatcccgacgagagggaatgaaccaatgaataagtgacacgttggattgggaaggtgggttctttaat |
52221284 |
T |
 |
| Q |
210 |
catgcgctcttccttccttgt----nnnnnnnnnnnnnaagaggtgattcatttcatttctaaatttctgggaatgaaacttcttctttttcttcgtggc |
305 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52221285 |
catgcgctcttccttccttgtatagagagagagagagaaagaggtgattcatttcatttctaaatttctgggaatgaaacttcttctttttcttcgtggc |
52221384 |
T |
 |
| Q |
306 |
attgtgattcaaaaaaggac-nnnnnnnnnttacgcaagttttgaaaacgcatatttgtttgctggcagagtgaagatggatcatgcatcagcagcacac |
404 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52221385 |
attgtgattcaaaaaaggacaaaaaaaaaattacgcaagttttgaaaacgcatatttgtttgctggcagagtgaagatggatcatgcatcagcagcacac |
52221484 |
T |
 |
| Q |
405 |
agcttgctgctgcc-----------ttgcgtggttggttttcaaatttcaggagttacctttgctt |
459 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52221485 |
agcttgctgctgccttgcgtttacgttgcgtggttggttttcaaatttcaggagttacctttgctt |
52221550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University