View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16446_high_5 (Length: 242)
Name: NF16446_high_5
Description: NF16446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16446_high_5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 9496921 - 9497145
Alignment:
| Q |
18 |
ggatgttaccttacctttgcaacctcccgagttacggagctgttctgcaacaagtgcatctttatcttccatgcacggaatgctccatgatgagattgac |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496921 |
ggatgttaccttacctctgcaacctcccgagttacggagctgttctgcaacaagtgcatctttatcttccatgcacggaatgctccatgatgagattgac |
9497020 |
T |
 |
| Q |
118 |
tctttctgtaaacaggtataggtatagagtatattttgtaggtgatgttactaacacacacttgcacttacagttgcatgcctctcgcatagtcttttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9497021 |
tctttctgtaaacaggtataggtatagagtatattttgtgggtgatgttactaacacacacttgcacttacagttgcatgcctctcgcatagtcttttgc |
9497120 |
T |
 |
| Q |
218 |
aagccagttgaaaaccctctgttcc |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9497121 |
aagccagttgaaaaccctctgttcc |
9497145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University