View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16447_high_7 (Length: 330)
Name: NF16447_high_7
Description: NF16447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16447_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 22 - 322
Target Start/End: Original strand, 37108221 - 37108521
Alignment:
| Q |
22 |
accaactgtaataatccaaggagcaagattttctgcagttgcatcctttggtccactattgccagcagagcaaacaacaataatacctttcttagcagca |
121 |
Q |
| |
|
||||||||| ||| ||||||||| |||||| |||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37108221 |
accaactgtgatataccaaggagctagatttgatgcagtagcatcatttggtccactattgccagcagagcaaacaacaacaatacctttcttagcagca |
37108320 |
T |
|
| Q |
122 |
tggaaagaaccaatagaagtaccgtcattgaaaacattagaagtagaggcaccaagtgacacagacaagacatcaacgccatcatggatagccacatcaa |
221 |
Q |
| |
|
|||||||| ||||||| | || |||||||||| ||||||| |||| |||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
37108321 |
tggaaagatccaatagcaacactatcattgaaaaggttagaagcagagccaccaagtgacacagacaagacatcaacaccatcatggatagctgcatcaa |
37108420 |
T |
|
| Q |
222 |
atgctgcaagtatgtctgcatcaaagcactcatcgccgttaattggaggaaaacaaactttgtatgatgcaactcttgcttttggtgaaccaccctttgc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37108421 |
atgctgcaagtatgtctgcatcaaagcactcgtcgccattaattggaggccaacaaactttgtatgatgcaactcttgcttttggtgaaccaccctttgc |
37108520 |
T |
|
| Q |
322 |
t |
322 |
Q |
| |
|
| |
|
|
| T |
37108521 |
t |
37108521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University