View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16447_low_13 (Length: 235)
Name: NF16447_low_13
Description: NF16447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16447_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 42480264 - 42480038
Alignment:
| Q |
9 |
tcatcaatcacaaccatgggttcaacaggtgaaactcaaataacaccaactcacatatcagatgaagaagcaaacctcttcgccgtgcaactagcaagtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42480264 |
tcatcaatcacaaccatgggttcaacaggtgaaactcaaataacaccaactcacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtg |
42480165 |
T |
|
| Q |
109 |
cctcagttcttcccatggttttaaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480164 |
cctcagttcttcccatggttttaaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaat |
42480065 |
T |
|
| Q |
209 |
tgcttctcagctcccaacaactaaccc |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42480064 |
tgcttctcagctcccaacaactaaccc |
42480038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University