View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16447_low_14 (Length: 210)
Name: NF16447_low_14
Description: NF16447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16447_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 56 - 191
Target Start/End: Complemental strand, 4555425 - 4555290
Alignment:
| Q |
56 |
ctgattaacttttctgaagcttggtttctttcttccaaattcatcaatggatggagccttgagaagctctctctttcgtattcttcgaacaggtattgtt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4555425 |
ctgattaacttttctgaagcttggtttctttcttccaaattcatcaatggatggagccttgagaagctctctctttcgtattcttcgaacaggtattgtt |
4555326 |
T |
|
| Q |
156 |
ccttttggacaacttccacttttctgccatacttgt |
191 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4555325 |
ccctttggacaacttccacttttctgccatacttgt |
4555290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 185
Target Start/End: Original strand, 47947884 - 47947941
Alignment:
| Q |
128 |
ctttcgtattcttcgaacaggtattgttccttttggacaacttccacttttctgccat |
185 |
Q |
| |
|
|||||| ||||| |||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
47947884 |
ctttcgaattctacgaataggtacagtttcttttggacaacttccacttttctgccat |
47947941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University