View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16448_low_9 (Length: 305)
Name: NF16448_low_9
Description: NF16448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16448_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 7565490 - 7565223
Alignment:
| Q |
19 |
ccattaccacctcctcagatgcccgcggagtatgtttatgtttttaagaaggaagttcactctctccgatttccaacttccctctattttaagcaactca |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7565490 |
ccattaccacctcctcagatgcccgtggaatatgttt------ttaagaaggaagttcagtctctccgatttccaacttcgctctattttaagcaactca |
7565397 |
T |
 |
| Q |
119 |
cctagcaccatcccagagacaaagattaagttccctttaaagactcgtgagattcatgctcaggtgattgactcttgcgatggcatcatctttttcagag |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7565396 |
cctagcaccatc---gagacaaagattaagttccctttaaacactcgtgacattcatgctcacgtgattgactcttgcgatggcatcatctttttcagag |
7565300 |
T |
 |
| Q |
219 |
tggaatgcgattaccaacatcgtagtatggtagcatggaacctttgtaccagaaaattgaagacattgccacctttg |
295 |
Q |
| |
|
|| ||| | ||||| ||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7565299 |
tgcaatacaattacaaacattgtaatatggtagcatggaacccttgtaccagaaaattgaagacattgccacctttg |
7565223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 214
Target Start/End: Complemental strand, 1442681 - 1442652
Alignment:
| Q |
185 |
attgactcttgcgatggcatcatctttttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1442681 |
attgactcttgcgatggcatcatctttttc |
1442652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University