View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1644_high_3 (Length: 300)
Name: NF1644_high_3
Description: NF1644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1644_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 26 - 213
Target Start/End: Original strand, 18715219 - 18715401
Alignment:
| Q |
26 |
atgttgaaagtaataaaacccataactatcctacataaattaacatcagacaatcgagttgaaacctgaggagaagtacactctaagatttcaaaccaac |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| || || |||| ||||||| | |||| ||||||||||||||||||| |
|
|
| T |
18715219 |
atgttgaaagtaataaaacccataactatcctacataaattgacatcagacaattgaattaaaacttgaggaggaatacaatctaagatttcaaaccaac |
18715318 |
T |
 |
| Q |
126 |
---actgagacaatcaaagtgagtttgtttatggaataaaattgattgattattcgattatcttttttaatgtgtatgtttccttcaatcg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18715319 |
actactgagacaatcaaagtgagtttgtttatggaataaa--------attactcgattatcttttttaatgtgtatgtttccttcaatcg |
18715401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University