View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16451_high_10 (Length: 273)
Name: NF16451_high_10
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16451_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 13213442 - 13213553
Alignment:
| Q |
15 |
aaaacccaccacaaatttcaagcaccatgttgattggtatatgaaactagctagctaagctacttttatttttatggaagtaaagtaaagagatggtagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13213442 |
aaaacccaccacaaatttcaagcaccatgttgattggtatatgaaactagctagctaagctactttt-tttttatggaagtaaagtaaagagatggtagt |
13213540 |
T |
|
| Q |
115 |
tcaaggtttggag |
127 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13213541 |
tcaaggtttggag |
13213553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 198 - 252
Target Start/End: Original strand, 13213622 - 13213676
Alignment:
| Q |
198 |
caacttaggaagcttttgtttatgcggtttaataataatgagattgaggatgctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13213622 |
caacttaggaagcttttgtttatgcggtttaataataatgagattgaggatgctg |
13213676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University