View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16451_low_12 (Length: 257)

Name: NF16451_low_12
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16451_low_12
NF16451_low_12
[»] chr5 (1 HSPs)
chr5 (23-161)||(20590775-20590913)


Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 23 - 161
Target Start/End: Complemental strand, 20590913 - 20590775
Alignment:
23 ggaactcaagatttcaacacttctattgtctactctgtaattttcattatatttttcattctttcttatcttatgtacgattccaagtaattaataaata 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20590913 ggaactcaagatttcaacacttctattgtctactctgtaattttcattatatttttcattctttcttatcttatgtacgattccaagtaattaataaata 20590814  T
123 tattttcataattagtgaagatgaaagttctaactctca 161  Q
    | |||||||||||||||||||||||||||||||||||||    
20590813 tgttttcataattagtgaagatgaaagttctaactctca 20590775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University