View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16451_low_12 (Length: 257)
Name: NF16451_low_12
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16451_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 23 - 161
Target Start/End: Complemental strand, 20590913 - 20590775
Alignment:
| Q |
23 |
ggaactcaagatttcaacacttctattgtctactctgtaattttcattatatttttcattctttcttatcttatgtacgattccaagtaattaataaata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20590913 |
ggaactcaagatttcaacacttctattgtctactctgtaattttcattatatttttcattctttcttatcttatgtacgattccaagtaattaataaata |
20590814 |
T |
 |
| Q |
123 |
tattttcataattagtgaagatgaaagttctaactctca |
161 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20590813 |
tgttttcataattagtgaagatgaaagttctaactctca |
20590775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University