View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16451_low_14 (Length: 241)
Name: NF16451_low_14
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16451_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 74 - 209
Target Start/End: Complemental strand, 43310857 - 43310721
Alignment:
| Q |
74 |
acaaaattacgctagtgaaggagaaatttgcaaatagaagcataatagcttggaagtagaagctatcaaacataaacaataatatacttgataata-ttc |
172 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43310857 |
acaaaattaggctagtgaaggagaaatttgcaaatagaagcataatagcttggaagtagaagctatcaaacataaacaataatatacttgataatatttc |
43310758 |
T |
 |
| Q |
173 |
ttattgagcaaacaatgagagggagaagaaaactcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43310757 |
ttattgagcaaacaatgagagggagaagaaaactcta |
43310721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 43310967 - 43310906
Alignment:
| Q |
18 |
aatagagttatatagttttctcacacagattctttctatctagttcatttgaaaacacaaaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43310967 |
aatagagttatatagttttctcacacagattctttccatctagttcatttgaaaacacaaaa |
43310906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University