View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16451_low_16 (Length: 238)
Name: NF16451_low_16
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16451_low_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 2489857 - 2489636
Alignment:
| Q |
17 |
acaatatttccaccccaaatacattgtctaatactagaatcaatcttgtttcatatgcccactgaaagccaatagttatacatggtgtaaatgggtataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489857 |
acaatatttccaccccaaatacattgtctaatactagaatcaatcttgtttcatatgccctctgaaagccaatagttatacatggtgtaaatgggtataa |
2489758 |
T |
 |
| Q |
117 |
agctaagaattaattttgccaaagtcactttctcgggtctacttgaaagcctaacttttcaaccagccaacctcgaagatctaatcaataaaataggaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489757 |
agctaagaattaattttgccaaagttactttctcgggtctacttgaaagcctaacttttcaaccagccaacctcgaagatctaatcaataaaataggaaa |
2489658 |
T |
 |
| Q |
217 |
aatatgcattggtaacccttcc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2489657 |
aatatgcattggtaacccttcc |
2489636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University