View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16451_low_19 (Length: 205)
Name: NF16451_low_19
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16451_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 187
Target Start/End: Original strand, 3191626 - 3191798
Alignment:
| Q |
15 |
cataggtgattgaaaaagactcaagagaatacaaatattttattattcatagtttgaaaatgactcaacatgcggaaatatgatgtgaacctgctctctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3191626 |
cataggtgattgaaaaagactcaagagaatacaaatattttattattcatagtttgaaaatgactcaacatgaggaaatatgatgtgaacctgctctctt |
3191725 |
T |
|
| Q |
115 |
acaaacagaacattacatgaaagatgtcttgtatcttattgagtaatttggaaggatggtgggtagtaatagg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3191726 |
acaaacagaacattacatgaaagatgtcttgtatcttattgagtaatttggaaggatggtgggtagtaatagg |
3191798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University