View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16451_low_5 (Length: 512)
Name: NF16451_low_5
Description: NF16451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16451_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 326; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 171 - 496
Target Start/End: Complemental strand, 42936415 - 42936090
Alignment:
| Q |
171 |
catatatttactgattttgctggaacaccttattggatggctcctgaggttattcactctcataatggttacagtttcaaagctgatatctggtcttttg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42936415 |
catatatttactgattttgctggaacaccttattggatggctcctgaggttattcactctcataatggttacagtttcaaagctgatatctggtcttttg |
42936316 |
T |
|
| Q |
271 |
ggataacagctttggagttagcacatggaagaccaccactttctcatcttcctccttctaagtcattgatgctaaacattacaaagaggtttaagttttc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42936315 |
ggataacagctttggagttagcacatggaagaccaccactttctcatcttcctccttctaagtcattgatgctaaacattacaaagaggtttaagttttc |
42936216 |
T |
|
| Q |
371 |
tgattttgataaacatagttacaagggtcatggtggtagtaacaaattctctaaggcttttaaggatatggttgctttatgtttgaatcaagatcctaca |
470 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42936215 |
tgattttgataaacatagttacaagggtcatggtggtagtaacaaattctctaaggcttttaaggatatggttgctttatgtttgaatcaagatcctaca |
42936116 |
T |
|
| Q |
471 |
aaaagaccctctgctgagaagttact |
496 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42936115 |
aaaagaccctctgctgagaagttact |
42936090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 9 - 130
Target Start/End: Complemental strand, 42936577 - 42936456
Alignment:
| Q |
9 |
ggacatcatcatagagatatcaaatccggtaacatccttgttgactcaaatggattagtgaaacttgcagattttggtgtttctgcttccatttatgaat |
108 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42936577 |
ggacatcttcatagagatatcaaatctggtaacatccttgttgactcaaatggattagtgaaacttgcagattttggtgtttctgcttccatttatgaat |
42936478 |
T |
|
| Q |
109 |
caaacaactctgtaggagcatg |
130 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42936477 |
caaacaactctgtaggagcatg |
42936456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University