View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16452_high_25 (Length: 236)
Name: NF16452_high_25
Description: NF16452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16452_high_25 |
 |  |
|
| [»] scaffold0440 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0440 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold0440
Description:
Target: scaffold0440; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 67 - 217
Target Start/End: Complemental strand, 11262 - 11112
Alignment:
| Q |
67 |
agtccaatttgttgtttccttttcatgaatgaaaattaagattgctagctaaacttgaatttgttgtgctttgtttaagcaggcaaataagaaaattgaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11262 |
agtccaatttgttgtttccttttcatgattgaaaattaagattgctagctaaacttgaatttgttgtgctttgtttaagtaggcaaataagaaaattgaa |
11163 |
T |
 |
| Q |
167 |
gatgctaagttggcaagagatttccaaaccacattgaaggaatttcagaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11162 |
gatgctaagttggcaagagatttccaaaccacattgaaggaatttcagaaa |
11112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 68 - 217
Target Start/End: Original strand, 32640462 - 32640611
Alignment:
| Q |
68 |
gtccaatttgttgtttccttttcatgaatgaaaattaagattgctagctaaacttgaatttgttgtgctttgtttaagcaggcaaataagaaaattgaag |
167 |
Q |
| |
|
|||||| ||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32640462 |
gtccaacttgctgttttgttttcatgattgaaaattaagattgctagctaaacttgaatttgttgtgctttgtttaagcaggcaaataagaaaattgaag |
32640561 |
T |
 |
| Q |
168 |
atgctaagttggcaagagatttccaaaccacattgaaggaatttcagaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
32640562 |
atgctaagttggcaagagatttccaaaccacattgcaagaatttcagaaa |
32640611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 78 - 165
Target Start/End: Complemental strand, 12663601 - 12663515
Alignment:
| Q |
78 |
ttgtttccttttcatgaatgaaaattaagattgctagctaaacttgaatttgttgtgctttgtttaagcaggcaaataagaaaattga |
165 |
Q |
| |
|
||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
12663601 |
ttgtttccttttcat-attgaaaattaagtttgctagctaaacttgaatttgttgtgctttttttaagcaggaaaataagaaaattga |
12663515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University