View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16452_low_10 (Length: 423)
Name: NF16452_low_10
Description: NF16452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16452_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 118 - 406
Target Start/End: Complemental strand, 30808887 - 30808599
Alignment:
| Q |
118 |
gttatcaaggaatcttagttgttattgtaaaggatgcttttcaattcaagattcgaaaatggctaagagaatgttagctattggtgaaattagaggcaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30808887 |
gttatcaaggaatcttagttgttattgtaaaggatgcttttcaattcaagattcgaaaatggctaagagaatgttagctattggtgaaattagaggcaag |
30808788 |
T |
 |
| Q |
218 |
tgcaattggaattatctaaagttattcgcctaatatctaatgtatgatgtatctaatgttttgcatttttctttataaaagttgggaccataacttttga |
317 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30808787 |
tgcaattggaattatctaaagttattctcctaatatctaatgtatgatgtatctaatgttttgcatttttctttttaaaagttgggaccataacttttga |
30808688 |
T |
 |
| Q |
318 |
ggtcgatagattttgcaatacctcactaaaatttatggataactagtgcatgtgaatgtgaagggaagaaatatcattggcacagacct |
406 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
30808687 |
ggtcgatagattttgcaatacatcactaaaatttatggatgactaacgcatgtgaatgtgaagggatgatttatcattgccacagacct |
30808599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 12 - 46
Target Start/End: Complemental strand, 30808993 - 30808959
Alignment:
| Q |
12 |
tattcttgaaggtttgtgtaagcatttagaacatg |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30808993 |
tattcttgaaggtttgtgtaagcatttagaacatg |
30808959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University