View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16452_low_22 (Length: 281)
Name: NF16452_low_22
Description: NF16452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16452_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 134504 - 134242
Alignment:
| Q |
1 |
tggttgtttgcatgagaagaagaagttgtcaataatgaattgaaagttaatattgtcggtgttgggccgaattaagaaggcagtgatgggtggattttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
134504 |
tggttgtttgcatgagaagaagaagttgtcaataatgaattgaaagttaatattgtcggtgttgggccgaattaagaaggcagtgatgggtggcttttgt |
134405 |
T |
|
| Q |
101 |
tgttgaacaattttgaaggactctcagctagttcttttgtcataaacacttggtttcacttataaatgttcaatctagtgatccgattttgacaaagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134404 |
tgttgaacaattttgaaggactctcagctagttcttttgtcataaacacttggtttcacttataaatgttcaatctagtgatccgattttgacaaagact |
134305 |
T |
|
| Q |
201 |
ttggagaggttaaggaagattgatgttcggtataaacaaattcatgtactatatcgatccttt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134304 |
ttggagaggttaaggaagattgatgttcggtataaacaaattcatgtactatatcgatccttt |
134242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 142 - 184
Target Start/End: Original strand, 6343691 - 6343733
Alignment:
| Q |
142 |
ataaacacttggtttcacttataaatgttcaatctagtgatcc |
184 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
6343691 |
ataaacacttgatctcacttataaatgttcaatctagtgatcc |
6343733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University