View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16453_high_21 (Length: 242)
Name: NF16453_high_21
Description: NF16453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16453_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 28927507 - 28927635
Alignment:
| Q |
1 |
attaaggtgagaacctaatcaatgaagggtgagaggatcagtttaatgcacaccatatactacctttgatgaaatttcgggaaacaaaaaggaaaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28927507 |
attaaggtgagaacctaatcaatgaagggtgagaggatcagtttaatgcacaccatatac---ctttgacaaaatttcgggaaacaaaaaggaaaaagat |
28927603 |
T |
 |
| Q |
101 |
ctttcatcatttcagcaacaaatagtagagaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28927604 |
ctttcatcatttcagcaacaaatagtagagaa |
28927635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University