View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16453_high_24 (Length: 224)
Name: NF16453_high_24
Description: NF16453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16453_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 9632344 - 9632562
Alignment:
| Q |
1 |
gcaaaatatggttttgtttttctttgttccatcagaagatgctaattgctaggtttaggtgcttgcaactgtagattctgtttttcaataactctagctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9632344 |
gcaaaatatggttttgtttttctttgttccatcagaagatgctaattgctaggtttaggtgcttgcaactgtagattctgtttttcaataactctagctc |
9632443 |
T |
 |
| Q |
101 |
tgtgccttctcttgaaaatatcttgcctgaatcgcttggtctcaatttgtatgtccatgaagggcctcttctctatgttttctttttcactttccaacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9632444 |
tgtgccttctcttgaaaatatcttgcctgaatcgcttggtctcaatttgtatgtccatgaaaggcctcttctctatgttttctttttcactttccaacat |
9632543 |
T |
 |
| Q |
201 |
cttttgccttcttctcact |
219 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
9632544 |
cttttgccttcttatcact |
9632562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University