View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16453_low_11 (Length: 431)
Name: NF16453_low_11
Description: NF16453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16453_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 365
Target Start/End: Original strand, 43164392 - 43164753
Alignment:
| Q |
1 |
aagggttgtatgcggaactttcggaggcgatggagtgtttggagcatatatgtacggaagggtgcaccgacgttggaccataccatgtggaggttaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164392 |
aagggttgtatgcggaactttcggaggcgatggagtgtttggagcatatatgtacggaagggtgcaccgacgttggaccataccatgtggaggttaataa |
43164491 |
T |
|
| Q |
101 |
agaaaagaaaccgtgtagcaaatactccacctgtcaagggcttcagcttctgattcgtcattttgcaacatgcaagaagagggtgaggggtgggtgcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| | |
|
|
| T |
43164492 |
agaaaagaaaccgtgtagcaaatactccacctgtcaagggcttcagcttctgattcgtcattttgcaacatgcaagaagagggtgaagggagggtgctgg |
43164591 |
T |
|
| Q |
201 |
aggtgcaaacgtatgtggcagctgtttagattgcattcatatgtttgccaacaaactcatgatgattcctgcaatgttcctctttgcaggttagttgttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164592 |
aggtgcaaacgtatgtggcagctgtttagattgcattcatatgtttgccaacaaactc---atgattcctgcaatgttcctctttgcaggttagttgttt |
43164688 |
T |
|
| Q |
301 |
taatattcatgcctaatgcaacttagctaccatattttatttatttacatcaatcatatgattta |
365 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
43164689 |
taatattcattcctaatgcaacttagctaccatattttatttatttacatcaatcacatgcttta |
43164753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University