View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16453_low_31 (Length: 212)
Name: NF16453_low_31
Description: NF16453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16453_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 9 - 102
Target Start/End: Original strand, 19949151 - 19949244
Alignment:
| Q |
9 |
ccttagttgaaagcattataagctcatcgaactgaaaccttattgcatgattgcttatgttacttatttcttatactagctaagctacatgaca |
102 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19949151 |
cctttgttgaaagcattataagctcatcgaactgaaaccttattgcatgtttgcttatgttacttatttcttatactagctaagctacatgaca |
19949244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 24838838 - 24838708
Alignment:
| Q |
1 |
aggttaggccttagttgaaagcattataagctcatcgaactgaaaccttattgcatgattgcttatgttacttatttcttatactagctaagctacatga |
100 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||| ||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
24838838 |
aggttaggccatagttgaaaacattattagctcaatgaactgaaaccttattgcatgttcacttatgttacttatttcttgtactagctaagcttcatga |
24838739 |
T |
|
| Q |
101 |
c-agaatgtt-aaaaaacaagaccaaatgaa |
129 |
Q |
| |
|
| |||||||| |||||||||||||||||||| |
|
|
| T |
24838738 |
caagaatgttgaaaaaacaagaccaaatgaa |
24838708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 134
Target Start/End: Complemental strand, 22688016 - 22687957
Alignment:
| Q |
76 |
ttcttatactagctaagctacatgaca-gaatgttaaaaaacaagaccaaatgaaacatg |
134 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||| ||||| || ||||||||||||||| |
|
|
| T |
22688016 |
ttcttatactagataagttacatgacaagaatgtttaaaaagaaaaccaaatgaaacatg |
22687957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University