View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16456_high_3 (Length: 309)
Name: NF16456_high_3
Description: NF16456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16456_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 290
Target Start/End: Complemental strand, 8091949 - 8091675
Alignment:
| Q |
16 |
attgatacggtgatttggtcgtgaggtgctagatgagcgattagagtttgactttgtaactttaaaggacgaaattaaaattctcggtaaaaaaggaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091949 |
attgatacggtgatttggtcgtgaggtgctagatgagtgattagaatttgactttgtaactttaaaggacgaaattaaaattctcggtaaaaaaggaaat |
8091850 |
T |
|
| Q |
116 |
cgatataataactgcgttgagacctggtacttctccctgtagatttttactgctgtagcatgagcaagaatctggtggtgtgtaactatgtaaggctcag |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091849 |
cgatataataactacgttgagacctggtacttctccctgtagatttttactgctgtagcatgagcaagaatctggtggtgtgtaactatgtaaggctcag |
8091750 |
T |
|
| Q |
216 |
tactagaatcaccaacactacaatttggtgatatccattttgaacatcttgctggtggaaactggccattagcat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091749 |
tactagaatcaccaacactacaatttggtgatatccattttgaacatcttgctggtggaaactggccattagcat |
8091675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 144 - 229
Target Start/End: Complemental strand, 7730393 - 7730308
Alignment:
| Q |
144 |
acttctccctgtagatttttactgctgtagcatgagcaagaatctggtggtgtgtaactatgtaaggctcagtactagaatcacca |
229 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||| |||| ||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7730393 |
acttctgcctgtagacttttactgctgcagcgtgagaaagaatcaggtggtgtgtaactacatagggctcagtactagaatcacca |
7730308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University