View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16457_low_3 (Length: 266)
Name: NF16457_low_3
Description: NF16457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16457_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 264
Target Start/End: Complemental strand, 52263243 - 52262988
Alignment:
| Q |
9 |
acatcatcatcaccactcaaagtacccattatttgagaatcaatatcaagaaggatctgtctcacagcaccaacatcacctctttgagctgctagatgaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263243 |
acatcatcatcaccactcaaagtacccattatttgagaatcaatatcaagaaggatctgtctcacagcaccaacatcacctctttgagctgctagatgaa |
52263144 |
T |
 |
| Q |
109 |
gctcagtatcgttgtgacgacccgttacttgctttacgtacttcttcttccctgcttgatcgatccgttttcctgagtttgaaaggaccagagctggcgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263143 |
gctcagtatcgttgtgacgacccgttacttgctttacgtacttcttcttccctgcttgatcgatccgttttcctgagtttgaaaggaccagagctggcgc |
52263044 |
T |
 |
| Q |
209 |
cgtcgctgacgacggagatggcgacggcgatatttcggaaagtgggttctgtgttg |
264 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
52263043 |
cgtcgctgacgacggagatggcgacggtgatatttcggaaagtgggttctgggttg |
52262988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University