View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16457_low_5 (Length: 217)
Name: NF16457_low_5
Description: NF16457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16457_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 53 - 200
Target Start/End: Original strand, 1797164 - 1797311
Alignment:
| Q |
53 |
gatggaattaaactttttaactatacactatataaaaaagcaagatagtaaatcttgagtagaacaatcattagtcacgatttatttacttttcaactga |
152 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1797164 |
gatggaattaaactttttaactatgcactatataaaaaagcaagatagtaaatcttgagtagaacaatcattagtcatgatttatttacttttcaactga |
1797263 |
T |
|
| Q |
153 |
attccgatttaccagacctcttttattgacaaaattgctataatatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1797264 |
attccgatttaccagacctcttttattgacaaaattgctataatatgt |
1797311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University