View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16458_high_7 (Length: 290)
Name: NF16458_high_7
Description: NF16458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16458_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 31587450 - 31587285
Alignment:
| Q |
8 |
tgatttaaattcgaactcattcatacaacattttatcactatgtgaatgtttttggtggatacgcataattatgagtccgattgatcacagattcacatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31587450 |
tgatttaaattcgaactcattcatacaacattttatcactatgtgaatgtttttggtggatacacataaatatgagtccgattgatcacagattcacatc |
31587351 |
T |
 |
| Q |
108 |
tatataataatcatgagttttgttttttgtaatgatattaatattaaatcatgagtataatttatcc |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31587350 |
tatataataatcatgagttttgt-ttttgtaatgatattaatattaaatcatgagtataatttatcc |
31587285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 206 - 272
Target Start/End: Complemental strand, 31587200 - 31587134
Alignment:
| Q |
206 |
aaaaataacgcgcatgctcctctccttggggataatatgcttactgttgttcctttttatcaaaccc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31587200 |
aaaaataacgcgcatgctcctctccttggggataatatgcttactggtgttcctttttatcaaaccc |
31587134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University