View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16458_low_11 (Length: 270)
Name: NF16458_low_11
Description: NF16458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16458_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 70 - 254
Target Start/End: Complemental strand, 20926491 - 20926307
Alignment:
| Q |
70 |
ttttatttgtgtgtgtctgtttcttctcttgttataactgcttctagtttgagtgttataaaaagtttttattattgagatggaagagtttgttatggag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20926491 |
ttttatttgtgtgtgtctgtttcttctcttgttataactgcttctagtttgagtgttataaaaagtttttattattgagatggaagagtttgttatggag |
20926392 |
T |
 |
| Q |
170 |
gaaaaaatggtgggtttttctaagaaagatgcaacttacatagccaaaggaaaacgcactaagaggttaagatttttgtctcctt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20926391 |
gaaaaaatggtgggtttttctaagaaagatgcaacatacatagccaaaggaaaacgcactaagaggttaagatttttgtctcctt |
20926307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University