View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16458_low_12 (Length: 218)
Name: NF16458_low_12
Description: NF16458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16458_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 32350435 - 32350246
Alignment:
| Q |
19 |
gatcaatggacaagtccgtttgaaatgttatcaagtcctcaaatgacattaattggattgaagaatcatctcaatcatannnnnnnngtttatcagacga |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32350435 |
gatcaatggacaagtgcgtttgaaatgttatcaagttctcaaatgacattaattggattgaagaatcatctcaatcatattttttt-gtttatcagacga |
32350337 |
T |
|
| Q |
119 |
acctactcgaaagatgactcatatttattaaagggggcc-tttgatctcattggcatatgataaacattttgattattattatgagtataa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32350336 |
acctactcgaaagatgactcatatttattaaagggagccttttgatctcattggcatatgataaacatgttgattactattatgagtataa |
32350246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 122 - 193
Target Start/End: Original strand, 41334427 - 41334498
Alignment:
| Q |
122 |
tactcgaaagatgactcatatttattaaagggggcctttgatctcattggcatatgataaacattttgatta |
193 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||| |||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
41334427 |
tacttgaaaggtgactcatatttattatggggagcctttgatctcattggcatctaataaacattttgatta |
41334498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 213
Target Start/End: Original strand, 41313551 - 41313644
Alignment:
| Q |
120 |
cctactcgaaagatgactcatatttattaaagggggcctttgatctcattggcatatgataaacattttgattattattatgagtataatctac |
213 |
Q |
| |
|
|||||||||||| |||||||||||| ||| || || ||||||||| ||||||| ||||||| |||||||||||||| |||| ||||| |||| |
|
|
| T |
41313551 |
cctactcgaaaggtgactcatatttgttatgcggagcttttgatctcgttggcatctgataaatattttgattattatcatgaatataaactac |
41313644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University