View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16459_high_7 (Length: 287)
Name: NF16459_high_7
Description: NF16459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16459_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 68 - 273
Target Start/End: Complemental strand, 17352929 - 17352724
Alignment:
| Q |
68 |
tgaagctatattcactggttattgcttctattatcctttgttgatgtggtggacctgttatagtttatgtcatttaatataaatcataccacctttcttt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17352929 |
tgaagctatattcactggttattgcttctattatccattgttgatgtggtggacctgttatagtttatgtcatttaatataaatcataccgcctttcttt |
17352830 |
T |
 |
| Q |
168 |
cctattggaattgacggttttagatctaataaaacttcataattcatattcttcctacgtttttcttttaatgattcagatcaatttttgaattgttata |
267 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17352829 |
cctattggaatttacggtttcagatctaataaaacttcataattcatattcttcctatgtttttcttttaatgattcagatcaatttttgaattgttata |
17352730 |
T |
 |
| Q |
268 |
acctat |
273 |
Q |
| |
|
|||||| |
|
|
| T |
17352729 |
acctat |
17352724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 17353017 - 17352968
Alignment:
| Q |
17 |
acatagtacgtagtcatgaattatctagtaatattttccatctggtattt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17353017 |
acatagtacgtagtcatgaattatctagtaatattttccatctggtattt |
17352968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University