View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16459_low_10 (Length: 237)
Name: NF16459_low_10
Description: NF16459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16459_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 26253482 - 26253686
Alignment:
| Q |
15 |
gaaggatttgagagttgtttgttcctagccacaatctcacaggtatatagnnnnnnnnnnnacggtatgagctgcatataggtgaatactctaatatgtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26253482 |
gaaggatttgagagttgtttgttcctagccacaatctcacaggtatatagttttttttt--acggtatgagctgcatataggtgaatactctaatatgtt |
26253579 |
T |
 |
| Q |
115 |
agagttttgtaaatattacaaaacttggtgaaataaacnnnnnnnnnttatgaaatgtcatataatttcaaataaattgtaaataagt--acttccaaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26253580 |
agagttttgtaaatattacaaaacttggtgaaataaac-taaaaaaattatgaaatgtcatataatttcaaataaattgtaaataagtacacttccaaac |
26253678 |
T |
 |
| Q |
213 |
atattttg |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
26253679 |
atattttg |
26253686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University