View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16459_low_13 (Length: 225)
Name: NF16459_low_13
Description: NF16459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16459_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 93
Target Start/End: Original strand, 44992573 - 44992648
Alignment:
| Q |
18 |
atatcagcaaagagtctattaaataattacatcaagtcttaagtcttacttgatgctagcaaatgcaatagagaag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44992573 |
atatcagcaaagagtctattaaataattacatcaagtcttaagtcttacttgatgctagcaaatgcaatagagaag |
44992648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 143 - 207
Target Start/End: Original strand, 44992698 - 44992762
Alignment:
| Q |
143 |
ttcattattgatgcagcctgaatgttttcatacattagatgaaggataagaatcaaccacataaa |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44992698 |
ttcattattgatgcagcctgaacgttttcatacattagatgaaggataagaatcaaccacataaa |
44992762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 44979923 - 44979969
Alignment:
| Q |
18 |
atatcagcaaagagtctattaaataattacatcaagtcttaagtctt |
64 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
44979923 |
atatcagcaaagagtcaattaaataattacaacaagtctgaagtctt |
44979969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 44980021 - 44980075
Alignment:
| Q |
143 |
ttcattattgatgcagcctgaatgttttcatacattagatgaaggataagaatca |
197 |
Q |
| |
|
|||||||| ||||||||| ||| ||||| || |||||||||||||||||||||| |
|
|
| T |
44980021 |
ttcattatagatgcagcccaaatcttttcctatattagatgaaggataagaatca |
44980075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University