View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1645_high_12 (Length: 211)
Name: NF1645_high_12
Description: NF1645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1645_high_12 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 4211394 - 4211218
Alignment:
Q |
16 |
gggtgttcagattgcacatcactaattgtgttgaagtgacaaagtggctagtgttcttaatctggcaaatggttctattggtgtccctcaaattttgtat |
115 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
4211394 |
gggtgttcagattgcacatcacaaattgtgttgaagtgacagagtggctagtgttcttaatctggcaaatggttctattggtgtccctcatattttgtat |
4211295 |
T |
|
Q |
116 |
gtcgggaaacatatcaatttttgtgctannnnnnnaagaggttaattcttgtgctattctgtttattgtgtggtcttc |
193 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
4211294 |
gtcgggaaacatatcaatttttgtgctatttttttaagagg-taattcttgtgctattctgtttattgtgtggtcttc |
4211218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12553 times since January 2019
Visitors: 1253