View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1645_high_8 (Length: 318)
Name: NF1645_high_8
Description: NF1645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1645_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 30104307 - 30103999
Alignment:
| Q |
1 |
aggtaggcaatttttgtagggttatcatagagaggttttgacttgaaaactaaaaaggaagtacatgactttttaaggccattgcagaggtatccttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30104307 |
aggtaggcaatttttgtagggttatcatagagaggttttgacttgaaaactaaaaaggaagtacatgattttttaaggccattgcagaggtatccttttg |
30104208 |
T |
 |
| Q |
101 |
gtacagaagaggtggtgttagtgcagtcaaagacagtgccattgaggtaaacttgttggcagttgaataactgagaaaacatacataggaacagaactgt |
200 |
Q |
| |
|
|||||| ||||| | ||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30104207 |
gtacagtagagggg---ttagtgcagtcaaagacagtgttattgaggtatacttgctggcagttgaataactgagaaaacatgcataggaacagaactgt |
30104111 |
T |
 |
| Q |
201 |
aaagtgaagaatgtggttgtgaagttccatgattaagtttctagtgaagacaagaaatgagttacacttcaattgttttcagtgtttaaagagatggttt |
300 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30104110 |
gaagtgaagaatgtagttgtaaagttccatgattaagtttctagagaagacaagaaatgagttacacttcaattgttttcagtgtttaaagagatggttt |
30104011 |
T |
 |
| Q |
301 |
agttcttctcac |
312 |
Q |
| |
|
||||||| |||| |
|
|
| T |
30104010 |
agttcttatcac |
30103999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University