View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1645_high_9 (Length: 249)
Name: NF1645_high_9
Description: NF1645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1645_high_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 8241879 - 8241641
Alignment:
| Q |
11 |
cataggtcaatatcatcgatacggttaatatagttccctctatagctgttccatggtggttt-acacaatagttgcaagtttgtggtgtcaaaaatgata |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8241879 |
cataggtcaatatcatctatacggttaatatagttccctctatagctgttccatggtggttttacacaacagttgcaagtttgtggtgtcaaaaatgata |
8241780 |
T |
 |
| Q |
110 |
ttttannnnnnnncaaacaaattattcttttattacgtgttattttgatatttatttaggttggatgaattcttgggtgaaacaactcatgagattttaa |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8241779 |
ttttattttttt-caaacaaattattcttttattacgtgttattttgatatttatttaggttggatgaattcttgggtgaaacaactcatgagattttaa |
8241681 |
T |
 |
| Q |
210 |
tttcatttcggttgaatttcaaattactctcttgaaaatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8241680 |
tttcatttcggttgaatttcaaattactcttttgaaaatc |
8241641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University