View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16460_high_5 (Length: 454)
Name: NF16460_high_5
Description: NF16460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16460_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 348
Target Start/End: Original strand, 34060970 - 34061294
Alignment:
| Q |
19 |
gacatatcttctgactttttctcaaacgataaaatatcgtattcataattttcaagtacaagtaataagnnnnnnnnnngcactattcttttatcggaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34060970 |
gacatatcttctgactttttctcaaacgataaaatatcgtattcataattttcaagtacaagtaataagtttttttt--gcactattcttttatcggaaa |
34061067 |
T |
 |
| Q |
119 |
aatccttaaacattgccttaattatatacaatgctcaatctacagctcataccttgcatataagttaatcatgttgatcacctacatgtctttggtgctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34061068 |
aatccttaaacattgccttaattatatacaatgctcaatctacagctcatactttgcatataaattaatcatgttgatcacctacatgtctttggtgctt |
34061167 |
T |
 |
| Q |
219 |
tgattgcattgatgttcttcttcnnnnnnnctttcctttgataaagattgcattgatgttctaatttggaataatatgaaatgtcgatgaacatcaaatt |
318 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34061168 |
tcattgcattgatgttcttctt---tttttctttcctttgataaagattgcattgatgttctaatttggaataatatgaaatgtcgttgaacatcaaatt |
34061264 |
T |
 |
| Q |
319 |
caaaattcttgtaaatattacttttgacac |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34061265 |
caaaattcttgtaaatattacttttgacac |
34061294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University