View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16460_low_12 (Length: 262)
Name: NF16460_low_12
Description: NF16460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16460_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 8931242 - 8931501
Alignment:
| Q |
9 |
atatacggtaaagactagatctcaaacatggacaagcaaagatcaattacaagagaaccacgacgtttccccttgtaacaaaataaacatggaagatgat |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
8931242 |
atatacgggaaagactagatctcaaacatggagaagcaaagatcaattacgagagaaccacgacgtttccccttataacaaaatatacatggaagatgat |
8931341 |
T |
|
| Q |
109 |
ttttcttatgtacnnnnnnnn--gtaagagcatatatttttcttatctact----taaatcatgtgagtgatgataaaatcaacaatcatgcatggctat |
202 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931342 |
ttttgttatgtacttttttttttgtaagagcatatatttttcttatctacttacttaaatcatgtgagtgatgataaaatcaacaatcatgcatggctat |
8931441 |
T |
|
| Q |
203 |
tttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttctcca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931442 |
tttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttctcca |
8931501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University