View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16460_low_12 (Length: 262)

Name: NF16460_low_12
Description: NF16460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16460_low_12
NF16460_low_12
[»] chr2 (1 HSPs)
chr2 (9-262)||(8931242-8931501)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 8931242 - 8931501
Alignment:
9 atatacggtaaagactagatctcaaacatggacaagcaaagatcaattacaagagaaccacgacgtttccccttgtaacaaaataaacatggaagatgat 108  Q
    |||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||    
8931242 atatacgggaaagactagatctcaaacatggagaagcaaagatcaattacgagagaaccacgacgtttccccttataacaaaatatacatggaagatgat 8931341  T
109 ttttcttatgtacnnnnnnnn--gtaagagcatatatttttcttatctact----taaatcatgtgagtgatgataaaatcaacaatcatgcatggctat 202  Q
    |||| ||||||||          ||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||    
8931342 ttttgttatgtacttttttttttgtaagagcatatatttttcttatctacttacttaaatcatgtgagtgatgataaaatcaacaatcatgcatggctat 8931441  T
203 tttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttctcca 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8931442 tttttcacattgcgacaaattaaccagtgtttatcaatcatcatactaaatgcttctcca 8931501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University