View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16460_low_2 (Length: 633)
Name: NF16460_low_2
Description: NF16460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16460_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 416; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 416; E-Value: 0
Query Start/End: Original strand, 150 - 616
Target Start/End: Original strand, 8931612 - 8932085
Alignment:
| Q |
150 |
ggatggcacgccagcttttgagatgagaaagcgattcagcactaaggtactctacaaggcttgctgttgcatttctcctgcttaagctttatcagcatac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931612 |
ggatggcacgccagcttttgagatgagaaagcgattcagcactaaggtactctacaaggcttgctgttgcatttctcctgcttaagctttatcagcatac |
8931711 |
T |
 |
| Q |
250 |
aacacaacttaaa-------gagaaacccgcacacgctaaacattagatggaacacatgcgagtacacaccaaaaagagataaaaataacgcacagagtg |
342 |
Q |
| |
|
|| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| || |
|
|
| T |
8931712 |
aagacaacttaaaatatcaggagaaacccgcacacgccaaacattagatggaacacatgcgagtacacaccgaaaaaagataaaaataacgcacagattg |
8931811 |
T |
 |
| Q |
343 |
aacgtggttcggcacttcatacctgctttcatgaaaacatctcagcataaagtatgcactgtaacctcaaggtgctaactcggtggtaagagtttagcat |
442 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931812 |
aacgtggttcggcacctcatacctgcattcatgaaaacatctcagcataaagtatgcactgtaacctcaaggtgctaactcggtggtaagagtttagcat |
8931911 |
T |
 |
| Q |
443 |
tgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatggttattagtccaataattggattacatcaaagtaagacagcaaaccatg |
542 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931912 |
tgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatggttattagtccaataattggattacatcaaagtaagacagcaaaccatg |
8932011 |
T |
 |
| Q |
543 |
tctactaaacatataaactcaatgtagcaaatcaaaacctcgctgtaaaatggtcaatacaagcagcatttgat |
616 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8932012 |
tctactaaacaaataaactcaatgtagcaaatcaaaacctcgctgtaaaatggtcaatacaagcagcatttgat |
8932085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 16 - 64
Target Start/End: Original strand, 8931478 - 8931526
Alignment:
| Q |
16 |
atcatcatactaaatgcttctccactcaacgagagaaacaattcattcc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931478 |
atcatcatactaaatgcttctccactcaacgagagaaacaattcattcc |
8931526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 2e-17; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 420 - 502
Target Start/End: Complemental strand, 49443658 - 49443576
Alignment:
| Q |
420 |
actcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatggttattagt |
502 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||| | ||||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
49443658 |
actctgtggtaagagtttagccttgtaacctcaaggtacaaagttcaaatcccctcggggacggttgtaaaatggttattagt |
49443576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 412 - 473
Target Start/End: Original strand, 50892220 - 50892281
Alignment:
| Q |
412 |
aggtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatcccc |
473 |
Q |
| |
|
|||||||| ||| |||||||||| ||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
50892220 |
aggtgctagctcagtggtaagagcttagccttgtaacctcaaggtgctgagttctaatcccc |
50892281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 473
Target Start/End: Complemental strand, 48751439 - 48751378
Alignment:
| Q |
412 |
aggtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatcccc |
473 |
Q |
| |
|
|||||||| || |||| ||||| |||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
48751439 |
aggtgctagctaagtggcaagagcttagcattgtaacctcaagttgctgagttcgaatcccc |
48751378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 412 - 473
Target Start/End: Original strand, 31584881 - 31584942
Alignment:
| Q |
412 |
aggtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatcccc |
473 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
31584881 |
aggtgctagctcaatggtaagagcttagcattgtaacctcaaggtactgagttcaaatcccc |
31584942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 425 - 481
Target Start/End: Original strand, 18332040 - 18332096
Alignment:
| Q |
425 |
gtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatccccactgggac |
481 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||| ||||||| |||| ||| ||||||| |
|
|
| T |
18332040 |
gtggcaagagcttagcattgtaacctcaaggtactgagtttaaataccctctgggac |
18332096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 412 - 493
Target Start/End: Complemental strand, 36198980 - 36198899
Alignment:
| Q |
412 |
aggtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatg |
493 |
Q |
| |
|
|||||||| || |||||||||| ||||| |||||||| |||||| |||||||||||||||| | |||| || ||||||||| |
|
|
| T |
36198980 |
aggtgctagcttagtggtaagagcttagccttgtaacctcaaggtactgagttcaaatcccctcggggatggttgtaaaatg |
36198899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 433 - 470
Target Start/End: Original strand, 23548584 - 23548621
Alignment:
| Q |
433 |
agtttagcattgtaaccgcaaggtgctgagttcaaatc |
470 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
23548584 |
agtttagcattgtaacctcgaggtgctgagttcaaatc |
23548621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 495
Target Start/End: Original strand, 43710570 - 43710653
Alignment:
| Q |
412 |
aggtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatggt |
495 |
Q |
| |
|
|||||||| | |||||||||||| ||||| |||||||| | ||||| ||||||| ||||||| | ||||| | ||| ||||||| |
|
|
| T |
43710570 |
aggtgctagcacggtggtaagagattagccttgtaaccccgaggtgttgagttcgaatcccctcggggacagttgtgaaatggt |
43710653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 412 - 502
Target Start/End: Original strand, 43427779 - 43427869
Alignment:
| Q |
412 |
aggtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatggttattagt |
502 |
Q |
| |
|
|||||||| ||| ||||||||||||| || |||||||| ||||| |||||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
43427779 |
aggtgctagctcagtggtaagagtttggccttgtaacctcaagggagggagttcaaatccccttggatacggttgtaaaatggttattagt |
43427869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 414 - 494
Target Start/End: Complemental strand, 253137 - 253058
Alignment:
| Q |
414 |
gtgctaactcggtggtaagagtttagcattgtaaccgcaaggtgctgagttcaaatccccactgggacggctgtaaaatgg |
494 |
Q |
| |
|
|||||| ||| |||||||||| ||||| |||||||| ||||| | ||||||||||||| | ||||||| |||||||||| |
|
|
| T |
253137 |
gtgctagctcagtggtaagagcttagccttgtaaccttaaggtacaaagttcaaatcccc-cggggacggttgtaaaatgg |
253058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University