View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16461_high_19 (Length: 269)
Name: NF16461_high_19
Description: NF16461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16461_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 27620031 - 27620274
Alignment:
| Q |
1 |
gatcgagggataccttcattgataaatttttattatcagtgtgagaatcttggtatagcagctgagcatggtggagatataaggttagtgttttgattgt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27620031 |
gatcgagggatgccttcattgataaatttttattatcagtgtgagaatcttggtatagcagttaagcatggtggagatataaggttagtgttttgattgt |
27620130 |
T |
 |
| Q |
101 |
gggttatttgcaattcaactgcatgtttatcataaatggtatgtcaattataatttcaaccacacttcttttatatgcataaacaatgtagtttttagac |
200 |
Q |
| |
|
|| |||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27620131 |
ggattatttgcaattcaac----tgttcatcataaacggtatgtcaattataatttcaaccacacttcttttatatgcataaacaatgtagtttctagac |
27620226 |
T |
 |
| Q |
201 |
aacttcttgaaattcggagagagggacaaaactctgacctccaggcca |
248 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
27620227 |
agcttcttgaaattcggagagagggacaaaactctaaactccaggcca |
27620274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 3 - 166
Target Start/End: Original strand, 35229058 - 35229217
Alignment:
| Q |
3 |
tcgagggataccttcattgataaatttttattatcagtgtgagaatcttggtatagcagctgagcatggtggagatataaggttagtgttttgattgtgg |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
35229058 |
tcgagggagaccttcattgataaattttgattatcagtttgagaatcttggtatagcagctgagcatggtggctatataaggttagtgttttgattgttg |
35229157 |
T |
 |
| Q |
103 |
gttatttgcaattcaactgcatgtttatcataaatggtatgtcaattataatttcaaccacact |
166 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35229158 |
gttatttgcaattcaac----tgtttatcataaacggtatgtcaattataatttcaaccacact |
35229217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 168 - 248
Target Start/End: Complemental strand, 27619888 - 27619808
Alignment:
| Q |
168 |
cttttatatgcataaacaatgtagtttttagacaacttcttgaaattcggagagagggacaaaactctgacctccaggcca |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27619888 |
cttttatatgcataaacaatgtagtttctagacagcttctttaaattcggagagagggacaaaactctgacctccaggcca |
27619808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 168 - 248
Target Start/End: Complemental strand, 35228913 - 35228833
Alignment:
| Q |
168 |
cttttatatgcataaacaatgtagtttttagacaacttcttgaaattcggagagagggacaaaactctgacctccaggcca |
248 |
Q |
| |
|
|||||||||||| |||||| |||||| | |||| |||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
35228913 |
cttttatatgcagaaacaacatagtttctggacagcttcttgaaattcggagacagggacaaaactctgaactccaggcca |
35228833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University