View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16461_high_26 (Length: 247)
Name: NF16461_high_26
Description: NF16461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16461_high_26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 247
Target Start/End: Original strand, 49123326 - 49123557
Alignment:
| Q |
16 |
accttcttgattcttggaaggaggtgtctgaagaggtatcaatatatctcgcaatgaaatgtaatttaatgtgttgtatacatgtattgcttctgtcctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49123326 |
accttcttgattcttggaaggaggtgtctgaagaggtatcaatatatctcacaatgaaatgtaatttaatgtgttgtatacatgtattgcttctgtcctt |
49123425 |
T |
 |
| Q |
116 |
atgtcaacgttttttacagggacgacttgcctttcgggctctattctccagagaggtgttgccccaaagcttttcacctcctcatgatttgataagtaag |
215 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49123426 |
atgtcagcgtcttttacagggacgacttgcctttcgggctctattctccagagaggtgttgccccaaagcttttcacctcctcatgatttgataaataag |
49123525 |
T |
 |
| Q |
216 |
gataatcagatggacagcatgaaggataacga |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
49123526 |
gataatcagatggacaacatgaaggataacga |
49123557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University