View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16461_high_28 (Length: 238)
Name: NF16461_high_28
Description: NF16461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16461_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36696178 - 36696399
Alignment:
| Q |
1 |
tttggttcagacaccattctataaaaatttcacaaccctaactaaaagttttagaaaattttgttatatggggttggtttaattatatttactatgggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36696178 |
tttggttcagacaccattctataaaaatttcacaaccctaactaaaagttttagaaaattttgttatatggggttggtttaattatatttattatgggaa |
36696277 |
T |
|
| Q |
101 |
atatttgaagcttctgctctattgaaaagcggaagagcagatagctttagaaggtatttgggtccataaatcctatttatagttgaggagagcacacaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36696278 |
atatttgaagcttctgctctattgaaaactggaagagcagatagctttagaaggtatttgggtccatacatcctatttatagttgaggagagcacacaaa |
36696377 |
T |
|
| Q |
201 |
tcataagctgaagagaatgaag |
222 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
36696378 |
tcataagctgaatagaatgaag |
36696399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University