View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16461_high_33 (Length: 222)
Name: NF16461_high_33
Description: NF16461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16461_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 95 - 208
Target Start/End: Original strand, 42479830 - 42479943
Alignment:
| Q |
95 |
ccagctttccatgagaactttatcctgattcatgaggttaagagcagaaatggatactccatcttcattcttaaccagatacttagcaacagtagccaaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42479830 |
ccagctttccatgagaactttatcctgattcatgaggttaagagcagaaatggatacaccatcttcattcttaaccaaatacttagcaacagtagccaaa |
42479929 |
T |
 |
| Q |
195 |
ccataaagtctctg |
208 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42479930 |
ccataaagtctctg |
42479943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University