View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16461_low_35 (Length: 222)

Name: NF16461_low_35
Description: NF16461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16461_low_35
NF16461_low_35
[»] chr3 (1 HSPs)
chr3 (95-208)||(42479830-42479943)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 95 - 208
Target Start/End: Original strand, 42479830 - 42479943
Alignment:
95 ccagctttccatgagaactttatcctgattcatgaggttaagagcagaaatggatactccatcttcattcttaaccagatacttagcaacagtagccaaa 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||    
42479830 ccagctttccatgagaactttatcctgattcatgaggttaagagcagaaatggatacaccatcttcattcttaaccaaatacttagcaacagtagccaaa 42479929  T
195 ccataaagtctctg 208  Q
    ||||||||||||||    
42479930 ccataaagtctctg 42479943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University