View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16461_low_9 (Length: 406)
Name: NF16461_low_9
Description: NF16461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16461_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 75 - 306
Target Start/End: Complemental strand, 48924417 - 48924188
Alignment:
| Q |
75 |
taaaggcatgattttggtgtttcatttaatctttataatctgtgtgataaaagatagccataatttcttatactaagtcaattaatctcttttcttgaaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48924417 |
taaaggcatgattttggtgtttcatttaatctttataatctgtgtgataaaagatagccataatttcttatactaagtcaattaatctcttttcttgaaa |
48924318 |
T |
|
| Q |
175 |
aagcgagaggaatacttttaagtaacctatgtgaagtgtgatgtatcgttgcatccttttctgaattgtatgttaggtgtttgataaaaaatgtctaatt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48924317 |
aagcgagaggaatacttttaagtaacctatgtgaagtgtgatgtatcgttgcatccttttctgaattgtatgttaggtgtttgat--aaaatgtctaatt |
48924220 |
T |
|
| Q |
275 |
tctaacctctgagattgtcttcaaaacataaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48924219 |
tctaacctctgagattgtcttcaaaacataaa |
48924188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 320 - 389
Target Start/End: Complemental strand, 48924204 - 48924135
Alignment:
| Q |
320 |
tgtcttcaaaacataaatgaatgatattattattattagacttattttcgatggtaattcactcccaatg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48924204 |
tgtcttcaaaacataaatgaatgatattattattattagacttattttcgatggtaattcactcccaatg |
48924135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University