View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16462_low_12 (Length: 425)
Name: NF16462_low_12
Description: NF16462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16462_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 279 - 406
Target Start/End: Original strand, 19067574 - 19067701
Alignment:
| Q |
279 |
catggtgtgttattgggatcttgaatgacattctgacggtggaagnnnnnnnggaagatcagggaggcatccttatttaattcaaagctttcgacaagca |
378 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||| ||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
19067574 |
catggtgtgttattggggacttgaatgacattcagacagtggaagaaaaaaaggaagatcagggaggcaaccttctttatttcaaagctttcgacaagca |
19067673 |
T |
 |
| Q |
379 |
gttcttgatgctggtcttattgatattc |
406 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
19067674 |
gttcttgatgctggtcttattaatattc |
19067701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University