View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16462_low_21 (Length: 275)
Name: NF16462_low_21
Description: NF16462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16462_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 128 - 261
Target Start/End: Original strand, 19710216 - 19710349
Alignment:
| Q |
128 |
cttgatgtccctatttttagaggcaagcccaagaaagtttatcttcaacctattgcagacaaggtgaaactgaaacttgtctcatggaaagcttcacttc |
227 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19710216 |
cttggtgtccctatttttagaggcaagcccaagaaagtttatcttcaacctattgcagacaaggtgaaactgaaacttgtatcatggaaagcttcacttc |
19710315 |
T |
 |
| Q |
228 |
tttcaattgcatggagggttcaattagtgaaatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19710316 |
tttcaattgcatggagggttcaattagtgaaatc |
19710349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 19710141 - 19710220
Alignment:
| Q |
17 |
aatgataaatgttaacaaatcaactactatgctggagctattagcaatgctaggcttcttcacatctctgatatgcttgg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19710141 |
aatgataaatgttaacaaatcaactactatactggagctattagcaatgctaggcttcttcacatctctgatatgcttgg |
19710220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University