View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16462_low_21 (Length: 275)

Name: NF16462_low_21
Description: NF16462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16462_low_21
NF16462_low_21
[»] chr6 (2 HSPs)
chr6 (128-261)||(19710216-19710349)
chr6 (17-96)||(19710141-19710220)


Alignment Details
Target: chr6 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 128 - 261
Target Start/End: Original strand, 19710216 - 19710349
Alignment:
128 cttgatgtccctatttttagaggcaagcccaagaaagtttatcttcaacctattgcagacaaggtgaaactgaaacttgtctcatggaaagcttcacttc 227  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
19710216 cttggtgtccctatttttagaggcaagcccaagaaagtttatcttcaacctattgcagacaaggtgaaactgaaacttgtatcatggaaagcttcacttc 19710315  T
228 tttcaattgcatggagggttcaattagtgaaatc 261  Q
    ||||||||||||||||||||||||||||||||||    
19710316 tttcaattgcatggagggttcaattagtgaaatc 19710349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 19710141 - 19710220
Alignment:
17 aatgataaatgttaacaaatcaactactatgctggagctattagcaatgctaggcttcttcacatctctgatatgcttgg 96  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
19710141 aatgataaatgttaacaaatcaactactatactggagctattagcaatgctaggcttcttcacatctctgatatgcttgg 19710220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University