View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16462_low_27 (Length: 238)
Name: NF16462_low_27
Description: NF16462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16462_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 38328135 - 38328335
Alignment:
| Q |
20 |
atatattaaccgtgttcatattctcacttctggttcaaaatcaaacaaatcagacatttggaatggtgatagtactcatacccgaaggaatggatatgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38328135 |
atatattaaccgtgttcatattctcacttctggttcaaaatcaaacaaatcagacatttggaatggtgatagtactcatacccgaaggaatggatatgtt |
38328234 |
T |
 |
| Q |
120 |
gattgttgagtaacatctaaggtggcatgtttctatcaacaacaacaaaaaattctaggtgatgtctgtgcttgccatttgccaacaaaccatccttcta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38328235 |
gattgttgagtaacatctaaggtggcatgtttctatcaacaacaacaaaaaatcctaggtgatgtctgtgcttgccatttgccaacaaaccatccttcta |
38328334 |
T |
 |
| Q |
220 |
t |
220 |
Q |
| |
|
| |
|
|
| T |
38328335 |
t |
38328335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 139 - 208
Target Start/End: Original strand, 38330021 - 38330088
Alignment:
| Q |
139 |
aggtggcatgtttctatcaacaacaacaaaaaattctaggtgatgtctgtgcttgccatttgccaacaaa |
208 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
38330021 |
aggtggcatgcttctagcaacaagaacaaaaaattctaggt--tgtgtgtgcttgccatttgtcaacaaa |
38330088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University