View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16462_low_29 (Length: 226)
Name: NF16462_low_29
Description: NF16462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16462_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 27 - 207
Target Start/End: Complemental strand, 33143427 - 33143259
Alignment:
| Q |
27 |
aaatatatgaaggatttcaatggaaggaaatgggacaagtttgatggcaaagaggttgcttcactcgaatatgcaaaaactcaaggaaaagatgcacatc |
126 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33143427 |
aaatatatgaaggatttcaatgggaggaaatgggacaagtttgatggcaaagaggttgcttcactcgaatatgcaaaa------------gatgcacatc |
33143340 |
T |
 |
| Q |
127 |
tagaggattattatcgcagggctccaaacttgatggaaagggaccagcagtttcgcccaatcgtcttttcaaagggccaag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33143339 |
tagaggattattatcgcagggctccaaacttgatggaaagggaccagcagtttcgcccaatcgtcttttcaaagggccaag |
33143259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 33143476 - 33143445
Alignment:
| Q |
1 |
ttctattgaatctattgcatatgcttaaatat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33143476 |
ttctattgaatctattgcatatgcttaaatat |
33143445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University