View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16465_high_3 (Length: 447)
Name: NF16465_high_3
Description: NF16465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16465_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 188 - 430
Target Start/End: Original strand, 10048642 - 10048889
Alignment:
| Q |
188 |
gagggtcaaattctcacgataattcttttttatgaagaattattataacatttggttaataagcaaatatgttggtatatcaataatcgtattagagcta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10048642 |
gagggtcaaattctcacgataattcttttttatgaagaattattataacatttggttaataagcaaatatgttggtatatcaataatcgtattggagcta |
10048741 |
T |
|
| Q |
288 |
gctaaaaatgtagttattcatgtcattgcatgaattacctcatttgttagtctccgactaaactcaacacgaatttcattaccctctttgtttttcctg- |
386 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
10048742 |
gctaaaaatgtagttattcatgtcattgcatgaattacctcatttgttagtctgcgactaaactcaacacaaattttattaccctctttatttttcctgc |
10048841 |
T |
|
| Q |
387 |
-gagcttgactcatcttcctctttcttatgat---cacctctactatg |
430 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
10048842 |
agagcttgactcatcttcctctttcttattattaccacctctactatg |
10048889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 53 - 120
Target Start/End: Original strand, 10048504 - 10048571
Alignment:
| Q |
53 |
atgaattgttcatgaaccttaggtttttagcaagctaattctcatcattttggagggagtagttcatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10048504 |
atgaattgttcatgaaccttaggtttttaacaagctaattctcatcattttggagggagtagttcatt |
10048571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 10047391 - 10047438
Alignment:
| Q |
1 |
atcgcacaagtatctcttttagcagttgttttggtccacaaaatggct |
48 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10047391 |
atcgcacaagtatctcttttatcagttgttttggtccacaaaatggct |
10047438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University