View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16465_low_7 (Length: 357)
Name: NF16465_low_7
Description: NF16465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16465_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 42229882 - 42230085
Alignment:
| Q |
19 |
tgtacaatagcagatatggtccaggttatcgtgacactgactatggtgttggaggaggagctactggagatccaatgcacaagggtggtcctgttggtgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42229882 |
tgtacaatagcagatatggtccaggttatcgtgacactgactatggtgttggaggaggagctactggagatccaatgcacaagggtggtcctgttggtgg |
42229981 |
T |
 |
| Q |
119 |
cacacgtgtttaaataaacatcattatccatataactacactttgtttcttg-tttttaataatattgtagtctcctagtttgggacacgggactatgtt |
217 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42229982 |
cactcgtgtttaaataaatatcattatccatataactacactttgtttcttgttttttaataatattgtagtttcctagtttgggacacgggactatgtt |
42230081 |
T |
 |
| Q |
218 |
cctg |
221 |
Q |
| |
|
|||| |
|
|
| T |
42230082 |
cctg |
42230085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 249 - 349
Target Start/End: Original strand, 42230113 - 42230213
Alignment:
| Q |
249 |
gggtttgttgtatgaagagtgtcactttgtagcattacgttgtgtataccaatggctgcaattaatcatgtatttgcaatttgcttatttctgttcttct |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42230113 |
gggtttgttgtatgaagagtgtcactttgtagcattacattgtgtataccaatggctgcaattaatcatgtatttgcaatttgcttatttctgttcttct |
42230212 |
T |
 |
| Q |
349 |
c |
349 |
Q |
| |
|
| |
|
|
| T |
42230213 |
c |
42230213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University